Sequence ID | >WENV170652793 |
Genome ID | JRYH01030191 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2817 |
End posion on genome | 2895 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
ttcaaataat |
tRNA gene sequence |
GCTGGCGTAGCTCAGAGGTAGAGCTCCTGGCTTCCACCCAGGGTATTTAGCGTGGGTTCG |
Downstream region at tRNA end position |
ctttttaaac |
Secondary structure (Cloverleaf model) | >WENV170652793 Gly TCC t TCCA ctttttaaac G - C C - G T - A G - C G + T C - G G - C T G T C A C C C A G A A | | | | | G A C T C G G T G G G C G | | | | T T G G A G C T A T GTATTTAGC C - G C - G T - A G - C G - C C C T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |