Sequence ID | >WENV170652797 |
Genome ID | JRYH01030756 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3933 |
End posion on genome | 4017 |
Amino Acid | Leu |
Anticodon | GAG |
Upstream region at tRNA start position |
caagtgaagc |
tRNA gene sequence |
GCCGACGTGGTGAAATTGGTAGACACGCTATCTTGAGGGGGTAGTGGCGAAAGCCGTATG |
Downstream region at tRNA end position |
cattccggga |
Secondary structure (Cloverleaf model) | >WENV170652797 Leu GAG c ACCA cattccggga G - C C - G C - G G - C A - T C - G G - C T G T T A C T C A T A A G | | | | | G T A G T G A T G A G C G | | | T T G A C A C T A G G TGGCGAAAGCCGT C - G T - A A - T T + G C - G T G T G G A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |