Sequence ID | >WENV170652800 |
Genome ID | JRYH01032445 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 88 |
End posion on genome | 164 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
aacacccaat |
tRNA gene sequence |
GCCCAAGTGGTGGAATTGGCATACACGGCAGTCTTAGAAACTGTTTATTGTGAGTTCGAG |
Downstream region at tRNA end position |
tgcctttgta |
Secondary structure (Cloverleaf model) | >WENV170652800 Leu TAG t ACAA tgcctttgta G + T C - G C - G C - G A - T A - T G - C T G T C A C T C A T A A G | | | | | G T G G T G G T G A G C G | | | T T G A C A C C A T G TTATT G + T C - G A - T G - C T - A C A T A T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |