Sequence ID | >WENV170652801 |
Genome ID | JRYH01032445 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 166 |
End posion on genome | 240 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
tgggtacaat |
tRNA gene sequence |
GCCTTTGTAGTTTAATGGATAGAATAATTGGCTACGAACCAATAGGTGCGAGTTCAAGTC |
Downstream region at tRNA end position |
acaatgcttt |
Secondary structure (Cloverleaf model) | >WENV170652801 Arg ACG t TCAA acaatgcttt G - C C - G C - G T - A T - A T - A G - C T G T C G T T C A T A A A | | + | | A G T T T G G C G A G C G + | | + T T A G A A T T A A AGGT A - T T - A T - A G - C G - C C A T A A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |