Sequence ID | >WENV170652802 |
Genome ID | JRYH01032574 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 538 |
End posion on genome | 463 |
Amino Acid | Phe |
Anticodon | GAA |
Upstream region at tRNA start position |
gccgggatgt |
tRNA gene sequence |
GCCCAGGTAGCTCAGTTGGTAGAGCATGCGACTGAAAATCGCAGTGTCGGTGGTTCGATT |
Downstream region at tRNA end position |
ttgcctcttc |
Secondary structure (Cloverleaf model) | >WENV170652802 Phe GAA t ACCA ttgcctcttc G - C C - G C - G C - G A - T G - C G - C T T T C C G C C A T G A A | | + | | G T C T C G G G T G G C G | | | | T T G G A G C T A A GTGTC T - A G - C C - G G - C A - T C A T A G A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |