Sequence ID | >WENV170652805 |
Genome ID | JRYH01033144 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 587 |
End posion on genome | 502 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
atattatcgt |
tRNA gene sequence |
GCCTCCTTGGTGGAATTGGTAGACGCGGGAGACTTAAAATCTCTTTCCTTTATGGAGTGC |
Downstream region at tRNA end position |
gaatatagtt |
Secondary structure (Cloverleaf model) | >WENV170652805 Leu TAA t ACCA gaatatagtt G - C C - G C - G T + G C - G C - G T - A T T T C G G C C A T A A G | | | | | G T G G T G G C C G G C G | + | T T G A C G C T A G G TTCCTTTATGGAGT G + T G - C A - T G - C A - T C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |