Sequence ID | >WENV170652806 |
Genome ID | JRYH01033144 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 488 |
End posion on genome | 415 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tatagttaat |
tRNA gene sequence |
GCTTCAGTAGTATAATGGTATTACACCGGCTTTGTAACCCGGCTATCTAAGTTCGATTCT |
Downstream region at tRNA end position |
atatggaagc |
Secondary structure (Cloverleaf model) | >WENV170652806 Thr TGT t GCCA atatggaagc G - C C - G T - A T - A C - G A - T G - C T T T G A T T C A A A A | | | | | G T T A T G C T A A G C G | | | T T G T T A C T A A CTAT C - G C - G G - C G - C C C T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |