Sequence ID | >WENV170652807 |
Genome ID | JRYH01033144 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 143 |
End posion on genome | 69 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
ctaagtttac |
tRNA gene sequence |
GGTCCTGTAGTGTAATGGATAACATACGGAGTTTCTACCTCCTTGATCTGGGTTCGAATC |
Downstream region at tRNA end position |
atacattatg |
Secondary structure (Cloverleaf model) | >WENV170652807 Arg TCT c GCCA atacattatg G - C G - C T - A C - G C - G T - A G - C T A T G A T C C A T A A A | | + | | G G T G T G C T G G G C G | | | + T T A A C A T T A A TGAT C T G - C G - C A - T G - C T C T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |