Sequence ID | >WENV170652809 |
Genome ID | JRYH01033651 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3043 |
End posion on genome | 2968 |
Amino Acid | Val |
Anticodon | TAC |
Upstream region at tRNA start position |
ccgttgcgtt |
tRNA gene sequence |
GGGCGGTTAGCTCAGCTGGAAGAGCGGCTGGTTTACACCCAGTAGGTCGGGAGTTCGAAC |
Downstream region at tRNA end position |
tcatcttctt |
Secondary structure (Cloverleaf model) | >WENV170652809 Val TAC t ACCA tcatcttctt G - C G - C G - C C - G G - C G - C T - A C A T C T C T C A C G A A | + | | | G T C T C G G G G A G C G | | | | T T G G A G C A A G AGGTC G + T C - G T - A G - C G - C T C T A T A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |