Sequence ID | >WENV170652811 |
Genome ID | JRYH01033989 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1261 |
End posion on genome | 1188 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
cccgcctcat |
tRNA gene sequence |
TGCCCCGTCGTCTAATGGTAAGACTACGGATTCTGATTCCGTCAATCGAGGTTCGAATCC |
Downstream region at tRNA end position |
gattttccta |
Secondary structure (Cloverleaf model) | >WENV170652811 Gln CTG t TCCA gattttccta T - A G - C C - G C - G C - G C - G G - C T A T G C T C C A A A C | | | | | G T T C T G C G A G G C G | | | | T T G A G A C T A T CAAT A - T C - G G - C G - C A - T T T T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |