Sequence ID | >WENV170652812 |
Genome ID | JRYH01034341 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1042 |
End posion on genome | 1128 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
cgggcccggt |
tRNA gene sequence |
GCGGTCGTGGCGGAATTGGCAGACGCGCAGCGTTGACGCCGCTGTGGGCTAACCCCCGTG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170652812 Val GAC t ACCA nnnnnnnnnn G - C C - G G - C G - C T - A C - G G - C G G T T C C T C A T A A G + | | | G T G G C G G G A A G C G | | | T T G A C G C C A G G TGGGCTAACCCCCGT C - G A - T G - C C - G G - C T C T G G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |