Sequence ID | >WENV170652813 |
Genome ID | JRYH01034369 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2508 |
End posion on genome | 2419 |
Amino Acid | Ser |
Anticodon | GCT |
Upstream region at tRNA start position |
tttgctaaat |
tRNA gene sequence |
AGAGAAGTGGCTGAGTCTGGCTTAAGGCATTCCTCTGCTAAGGGGACGGGGTTTAAAAGC |
Downstream region at tRNA end position |
aataaaattc |
Secondary structure (Cloverleaf model) | >WENV170652813 Ser GCT t GCat aataaaattc A - T G - C A - T G - C A - T A - T G - C T A T A T C C C A C T G A G | | | | | G T G T C G T A G G G C G + | | T T G A G G C C T T A A CGGGGTTTAAAAGCCTCC T - A T + G C - G C - G T + G C A T A G C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |