Sequence ID | >WENV170652816 |
Genome ID | JRYH01035441 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1498 |
End posion on genome | 1580 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
ccaccatttt |
tRNA gene sequence |
GCGAGAGTGGCGGAACTGGCAGACGCGCAGGATTTAGGATCCTGTACCACCCGGTGTGGG |
Downstream region at tRNA end position |
ctcaacctgt |
Secondary structure (Cloverleaf model) | >WENV170652816 Leu TAG t ACac ctcaacctgt G - C C - G G - C A - T G - C A - T G - C T C T C C C C C A C A A G | | | | | G T G G C G G G G G G C G | | | T T G A C G C C A G G TACCACCCGGTGT C - G A - T G - C G - C A - T T A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |