Sequence ID | >WENV170652820 |
Genome ID | JRYH01037040 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 155 |
End posion on genome | 231 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cggccttgtg |
tRNA gene sequence |
GCGATCGTAGCTCAGTTGGTTAGAGCACCGGTTTGTGGTACCGGGGGTCGTGGGTTCAAG |
Downstream region at tRNA end position |
ttttcccacg |
Secondary structure (Cloverleaf model) | >WENV170652820 His GTG g CCCA ttttcccacg G - C C - G G - C A - T T + G C - G G - C T G T T A C C C A T G A A + | | | | A T C T C G G T G G G C G | | | | T T G G A G C T T A A GGGTC C - G C - G G - C G - C T - A T T T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |