Sequence ID | >WENV170652821 |
Genome ID | JRYH01037083 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2466 |
End posion on genome | 2393 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gcgcagccgg |
tRNA gene sequence |
GCGGGTATGGTGAAATGGTATCATGAGAGCCTTCCAAGCTCCAGGTGCGGGTTCGATTCC |
Downstream region at tRNA end position |
ggaaatcccg |
Secondary structure (Cloverleaf model) | >WENV170652821 Gly TCC g TCCA ggaaatcccg G - C C - G G - C G - C G - C T - A A - T T T T C G C C C A A A G | | | | | G T A G T G G C G G G C G | | | + T T G T C A T T A G AGGT A C G - C A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |