Sequence ID | >WENV170652822 |
Genome ID | JRYH01037240 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 423 |
End posion on genome | 498 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
ggagcgcgtt |
tRNA gene sequence |
GCCCTTGTAGCTCAGCTGGTAGAGCAGCGGTTTTGTAAACCGAAGGTCGCGGGTTCGATC |
Downstream region at tRNA end position |
tttctcctgt |
Secondary structure (Cloverleaf model) | >WENV170652822 Thr TGT t ACCA tttctcctgt G - C C - G C - G C - G T + G T + G G - C C T T C G T C C A C G A A | | + | | G T C T C G G C G G G C G | | | | T T G G A G C T A A AGGTC G A C - G G - C G - C T - A T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |