Sequence ID | >WENV170652823 |
Genome ID | JRYH01037546 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 2145 |
End posion on genome | 2070 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cccggccatt |
tRNA gene sequence |
GCCCCTATAGCTCAGCTGGTAGAGCAACTGATTTGTAATCAGTAGGTCCGCGGTTCGAGT |
Downstream region at tRNA end position |
gccgccggtt |
Secondary structure (Cloverleaf model) | >WENV170652823 Thr TGT t ACCA gccgccggtt G - C C - G C - G C - G C - G T + G A - T T G T G T G C C A C G A A | + | | | G T C T C G C G C G G C G | | | | T T G G A G C T A A AGGTC A - T C - G T - A G - C A - T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |