Sequence ID | >WENV170652827 |
Genome ID | JRYH01038940 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1122 |
End posion on genome | 1047 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
agtaaagaat |
tRNA gene sequence |
GGTCCTATGGTGTAATGGAGAGCATCAAAGCCTTCTAAGCTTTTAGGTCAGGGTTCGAAT |
Downstream region at tRNA end position |
ttatctagtc |
Secondary structure (Cloverleaf model) | >WENV170652827 Arg TCT t GCCA ttatctagtc G - C G - C T - A C - G C - G T - A A - T T A T G T T C C A T A A G | | + | | G G T G T G C A G G G C G + | | + T T A G C A T G A C TAGGT A - T A - T A - T G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |