Sequence ID | >WENV170652828 |
Genome ID | JRYH01038940 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 918 |
End posion on genome | 825 |
Amino Acid | Ile |
Anticodon | TAT |
Upstream region at tRNA start position |
gtagctatta |
tRNA gene sequence |
GCGCCGGTAGTTTAGCGGTAAAACACCTGCCTTATAAGCAGCATAGTCCCCAGATTAGGG |
Downstream region at tRNA end position |
attattttaa |
Secondary structure (Cloverleaf model) | >WENV170652828 Ile TAT a ACCA attattttaa G - C C - G G - C C - G C - G G - C G - C T A T C C G T C A G A A | | | | | G C T T T G G G C A G C G | | | | T T G A A A C T A A ATAGTCCCCAGATTAGGGAGTATC C C C - G T - A G - C C - G C A T A T A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |