Sequence ID | >WENV170652830 |
Genome ID | JRYH01041408 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 122 |
End posion on genome | 33 |
Amino Acid | Ser |
Anticodon | GGA |
Upstream region at tRNA start position |
cgctctgaac |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTCGATGGCGCACGCTTGGAAAGCGTGTGGGCGTTAACGCGTC |
Downstream region at tRNA end position |
gtatttcaag |
Secondary structure (Cloverleaf model) | >WENV170652830 Ser GGA c GCCA gtatttcaag G - C G - C A - T C - G A - T G - C G + T T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G + | | | T T T T G G C C G A G TGGGCGTTAACGCGTCCC C - G A - T C - G G - C C - G T A T A G G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |