Sequence ID | >WENV170652832 |
Genome ID | JRYH01041787 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 953 |
End posion on genome | 864 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
taacaccccc |
tRNA gene sequence |
GGAGCAGTGGCCGAGTGGTCGAAGGCAACCGACTTGAAATCGGTCGGGCCAGCGATGGTC |
Downstream region at tRNA end position |
cttgcccccg |
Secondary structure (Cloverleaf model) | >WENV170652832 Ser TGA c GCCA cttgcccccg G - C G - C A - T G - C C - G A - T G - C T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C C G A A CGGGCCAGCGATGGTCCC A - T C - G C - G G - C A - T C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |