Sequence ID | >WENV170652834 |
Genome ID | JRYH01041962 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 75 |
End posion on genome | 1 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
agctggttga |
tRNA gene sequence |
CGCGGGATGGAGCAGCCCGGTAGCTCGTCAGGCTCATAACCTGAAGGTCGCAGGTTCAAA |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170652834 Met CAT a ACnn nnnnnnnnnn C A G - C C - G G - C G - C G - C A - T T A T C G T C C A C G A G | | | | | A C C G A G G C A G G C C | | | | T T G G C T C G T A G AGGTC T - A C - G A - T G - C G - C C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |