Sequence ID | >WENV170652835 |
Genome ID | JRYH01041975 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 637 |
End posion on genome | 560 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
gttgagaacg |
tRNA gene sequence |
GGGCTGGTAGCTCAACTGGAACAGAGCGCGGGAATCCGGCTCCCGAGGCTGTGGGTTCGA |
Downstream region at tRNA end position |
ccgcctatga |
Secondary structure (Cloverleaf model) | >WENV170652835 Arg CCG g GCCA ccgcctatga G - C G - C G - C C - G T - A G - C G - C T A T C G T C C A T C A A A | + + | | G G C T C G G T G G G C G | | | | T T A G A G C A C A G AGGCT C - G G - C G - C G - C A - T A C T G C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |