Sequence ID | >WENV170652836 |
Genome ID | JRYH01043115 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 362 |
End posion on genome | 437 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
tcacagttaa |
tRNA gene sequence |
GCCGTAATAGCTCAGTTGGCAGAGCGCCTGCCTTGTAAGCAGGAGGTCCGGGGTTCGATG |
Downstream region at tRNA end position |
aaacaaattg |
Secondary structure (Cloverleaf model) | >WENV170652836 Thr TGT a ACCA aaacaaattg G - C C - G C - G G - C T + G A - T A - T G T T G C T C C A T G A A | | + | | G T C T C G C G G G G C G | | | | T T G G A G C C A G AGGTC C - G C - G T - A G - C C - G C A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |