Sequence ID | >WENV170652842 |
Genome ID | JRYH01044334 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 14 |
End posion on genome | 87 |
Amino Acid | Arg |
Anticodon | ACG |
Upstream region at tRNA start position |
gatctcttaa |
tRNA gene sequence |
GCCTCTATAGCTTAAATGGAAAAGCACTCAACTACGGATTGAGAGAATGAAAGTTCAAGT |
Downstream region at tRNA end position |
attatggccc |
Secondary structure (Cloverleaf model) | >WENV170652842 Arg ACG a TCtt attatggccc G + T C - G C - G T - A C - G T - A A - T T G T C T T T C A A A A A | | | | | A T T T C G G A A A G C G | | | | T T G A A G C A A A AGAAT C - G T - A C - G A - T A - T C A T G A C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |