Sequence ID | >WENV170652845 |
Genome ID | JRYH01044685 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 319 |
End posion on genome | 234 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
tcgttcctct |
tRNA gene sequence |
GCCGGGGTGGCGGAATTGGTAGACGCAGTGGCCTTAGGAGCCACCGTCCTCTGGACGTGC |
Downstream region at tRNA end position |
atcctcagcg |
Secondary structure (Cloverleaf model) | >WENV170652845 Leu TAG t ACCA atcctcagcg G + T C - G C - G G - C G - C G - C G - C T G T T G T C C A T A A G + | | | | G T G G C G G C A G G C G | | | T T G A C G C T A G A CGTCCTCTGGACGT G - C T - A G - C G - C C - G C A T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |