Sequence ID | >WENV170652847 |
Genome ID | JRYH01045282 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 231 |
End posion on genome | 317 |
Amino Acid | Thr |
Anticodon | TGT |
Upstream region at tRNA start position |
cgcataaatc |
tRNA gene sequence |
GCCATCTTGCCCGAGTGGTTGAAGGGACTGGTTTTGTAATCCAGTAGCGCAAGCTCACCG |
Downstream region at tRNA end position |
attgacaaag |
Secondary structure (Cloverleaf model) | >WENV170652847 Thr TGT c ACCA attgacaaag G - C C - G C - G A - T T - A C - G T - A T A T C G T C C A T G A G | | | | | G G G C C C G C A G G C G | | | T T T A G G G T G A A TAGCGCAAGCTCACC C - G T - A G - C G - C T T T A T A T G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |