Sequence ID | >WENV170652848 |
Genome ID | JRYH01045772 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 3521 |
End posion on genome | 3445 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
atcggccggt |
tRNA gene sequence |
CGGAGCGTAGCGCAGCCTGGTAGCGCACCAGACTGGGGGTCTGGGGGTCGTGGGTTCGAA |
Downstream region at tRNA end position |
tttcttccaa |
Secondary structure (Cloverleaf model) | >WENV170652848 Pro GGG t ACCA tttcttccaa C - G G - C G - C A - T G - C C - G G - C T A T C G C C C A C G A A | + | | | G C C G C G G T G G G C T | | | | T T G G C G C G T A A GGGTC C - G C - G A - T G - C A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |