Sequence ID | >WENV170652850 |
Genome ID | JRYH01048374 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 4 |
End posion on genome | 93 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
nnnnnnncac |
tRNA gene sequence |
GGACAGGTGGCCGAGTGGTTTAAGGCAGCGGTCTTGAAAACCGCCGTGCGGGCAACCGTA |
Downstream region at tRNA end position |
ttttccccgc |
Secondary structure (Cloverleaf model) | >WENV170652850 Ser TGA c GCCA ttttccccgc G - C G - C A - T C - G A - T G - C G - C T A T C A C C C A T G A G | | | | | G G G C C G G T G G G C G | | | T T T A G G C T T A A CGTGCGGGCAACCGTACC G - C C - G G - C G - C T - A C A T A T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |