Sequence ID | >WENV170652851 |
Genome ID | JRYH01050748 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 249 |
End posion on genome | 172 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
acattttcga |
tRNA gene sequence |
CGCACGGTAGAGCAGGCAGGTTAGCTCGGCGGTCTCATAATCCGCAGGTCGTCGGTTCAA |
Downstream region at tRNA end position |
tcttcgcccg |
Secondary structure (Cloverleaf model) | >WENV170652851 Met CAT a ACCA tcttcgcccg C A G - C C - G A - T C - G G - C G - C T A T C A G C C A C G G A A | | | | | A A C G A G G T C G G C G | | | | T T G G C T C T T A G AGGTC G - C C - G G - C G - C T T C A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |