Sequence ID | >WENV170652852 |
Genome ID | JRYH01050748 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 166 |
End posion on genome | 93 |
Amino Acid | Thr |
Anticodon | CGT |
Upstream region at tRNA start position |
aaccatcttc |
tRNA gene sequence |
GCCCGTATAGCTCAATGGCAGAGCACCGCTTTCGTAAGACGGCGACGTGGGTTCGATTCC |
Downstream region at tRNA end position |
tcgccgggta |
Secondary structure (Cloverleaf model) | >WENV170652852 Thr CGT c ACCA tcgccgggta G - C C - G C - G C - G G - C T + G A - T T T T C G T C C A A A A | + + | | G T C T C G G T G G G C G | | | | T T G G A G C C A A CGAC C - G C - G G - C C A T + G T A T A C G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |