Sequence ID | >WENV170652856 |
Genome ID | JRYH01052712 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 245 |
End posion on genome | 326 |
Amino Acid | Leu |
Anticodon | TAA |
Upstream region at tRNA start position |
ggtttttaac |
tRNA gene sequence |
GGGGATGTGGTGAAATGGTAAACACGAATCGCTTAAAACGATTTGCTTATGCTTGCGGGT |
Downstream region at tRNA end position |
ttcttaaaag |
Secondary structure (Cloverleaf model) | >WENV170652856 Leu TAA c ACCA ttcttaaaag G + T G - C G - C G - C A - T T T G - C T G T C G C C C A T A A G | | | | | G G A G T G G C G G G C G | | | T T T A C A C A A G TGCTTATGCTT A - T A - T T - A C - G G - C C A T A T A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |