Sequence ID | >WENV170652858 |
Genome ID | JRYH01054313 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 402 |
End posion on genome | 326 |
Amino Acid | His |
Anticodon | GTG |
Upstream region at tRNA start position |
cggcaccgat |
tRNA gene sequence |
GCAGTTGTAGCTCAGTTGGTTAGAGCGCCTGTCTGTGGAACAGGAGGTCGGTGGTTCGAG |
Downstream region at tRNA end position |
cctgacccct |
Secondary structure (Cloverleaf model) | >WENV170652858 His GTG t ACCA cctgacccct G + T C - G A - T G - C T - A T - A G - C T G T C C A C C A T G A A | | | | | G T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G C - G T - A G - C T - A C A T G G T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |