Sequence ID | >WENV170652860 |
Genome ID | JRYH01054742 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 160 |
End posion on genome | 85 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
tcgcccgcac |
tRNA gene sequence |
GCCCCGGTAGCTCAGCGGATAGAGCGGCTGCCTTCTAAGCAGCGGGTCGCAGGTTCGATT |
Downstream region at tRNA end position |
tcggggggcg |
Secondary structure (Cloverleaf model) | >WENV170652860 Arg TCT c GCCA tcggggggcg G - C C - G C - G C - G C - G G - C G - C T T T C G T C C A C G A A | | | | | G G C T C G G C A G G C G | | | | T T A G A G C T A G GGGTC G - C C - G T - A G - C C - G C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |