Sequence ID | >WENV170652863 |
Genome ID | JRYH01056522 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 258 |
End posion on genome | 331 |
Amino Acid | Gly |
Anticodon | TCC |
Upstream region at tRNA start position |
gaggatccgc |
tRNA gene sequence |
GCGGGCATGGTGAAATGGTATCACACGAGCCTTCCAAGCTCTTGGTGCGGGTTCGATTCC |
Downstream region at tRNA end position |
ttcctctcct |
Secondary structure (Cloverleaf model) | >WENV170652863 Gly TCC c TCCA ttcctctcct G - C C - G G - C G - C G - C C - G A - T T T T C G C C C A A A G | | | | | G T A G T G G C G G G C G | | | | T T G T C A C T A A TGGT C T G - C A - T G - C C - G C A T A T C C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |