Sequence ID | >WENV170652866 |
Genome ID | JRYH01058954 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 401 |
End posion on genome | 324 |
Amino Acid | Pro |
Anticodon | TGG |
Upstream region at tRNA start position |
aatttatatt |
tRNA gene sequence |
CGGGGTGTAGCGTAGCCCGGTTATCGCGCCTGGTTTGGGACCAGGAGGTCGGAGGTTCGA |
Downstream region at tRNA end position |
aagcctcttg |
Secondary structure (Cloverleaf model) | >WENV170652866 Pro TGG t ACAA aagcctcttg C - G G - C G - C G - C G - C T - A G - C T A T T C T C C A C C G A A + | | | | G C T G C G G G A G G C G | | | T T G T C G C T T A G AGGTC C - G C - G T - A G - C G - C T A T G T G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |