Sequence ID | >WENV170652867 |
Genome ID | JRYH01059644 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 390 |
End posion on genome | 466 |
Amino Acid | Pro |
Anticodon | GGG |
Upstream region at tRNA start position |
tcgggccggt |
tRNA gene sequence |
CGGGACGTAGCGCAGCCTGGTAGCGCATCACACTGGGGGTGTGGGGGTCGGAGGTTCGAA |
Downstream region at tRNA end position |
atttcttccg |
Secondary structure (Cloverleaf model) | >WENV170652867 Pro GGG t ACCA atttcttccg C - G G - C G - C G - C A - T C - G G - C T A T T C T C C A C G A A + | | | | G C C G C G G G A G G C T | | | | T T G G C G C G T A A GGGTC T + G C - G A - T C - G A - T C G T G G G G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |