Sequence ID | >WENV170652869 |
Genome ID | JRYH01060441 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1439 |
End posion on genome | 1364 |
Amino Acid | Ser |
Anticodon | TGA |
Upstream region at tRNA start position |
attttacaag |
tRNA gene sequence |
GGGGCGTTAGTGTAGTTGGTTAACATACAAGTCTTGACACCTTGTGAGACGGGTTCGATT |
Downstream region at tRNA end position |
taaaataaaa |
Secondary structure (Cloverleaf model) | >WENV170652869 Ser TGA g ACTA taaaataaaa G - C G - C G + T G - C C - G G + T T - A T T T T G C C C A T G A A | | | | | G T T G T G A C G G G C G | | | + T T G A C A T T T A A TGAG C - G A - T A - T G - C T C C A T C T G A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |