Sequence ID | >WENV170652871 |
Genome ID | JRYH01060917 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 236 |
End posion on genome | 312 |
Amino Acid | Asn |
Anticodon | GTT |
Upstream region at tRNA start position |
atccggcccc |
tRNA gene sequence |
GCCCGAATAGCTCAGCCGGTTAGAGCACTTGACTGTTAATCAGGGGGTCGTTGGTTCGAG |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170652871 Asn GTT c GCCA nnnnnnnnnn G - C C - G C - G C - G G - C A - T A - T T G T C A A C C A C G A A | | | | | G C C T C G G T T G G C G | | | | T T G G A G C T T A A GGGTC C - G T + G T - A G - C A - T C A T A G T T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |