Sequence ID | >WENV170652873 |
Genome ID | JRYH01064497 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 343 |
End posion on genome | 257 |
Amino Acid | Leu |
Anticodon | CAA |
Upstream region at tRNA start position |
tcgttaccgg |
tRNA gene sequence |
GCCCCTGTGGCGGAATTGGTAGTCGCGGCAGACTCAAAATCTGTTTCCCGCAAGGGAGTG |
Downstream region at tRNA end position |
ttccacgagc |
Secondary structure (Cloverleaf model) | >WENV170652873 Leu CAA g ACCA ttccacgagc G - C C - G C - G C - G C - G T - A G - C T G T C G G G C A T A A G | | | | | G T G G C G G C C C G C G + | | | T T G T C G C T A G G TTCCCGCAAGGGAGT G + T C - G A - T G - C A - T C A T A C A A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |