Sequence ID | >WENV170652875 |
Genome ID | JRYH01066766 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 122 |
End posion on genome | 206 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
taggtttgct |
tRNA gene sequence |
GGAGGGGTACTCAAGCGGTCAACGAGGGCAGACTGTAAATCTGCTGACTATGTCTTCGCA |
Downstream region at tRNA end position |
ttattttttc |
Secondary structure (Cloverleaf model) | >WENV170652875 Tyr GTA t ACTA ttattttttc G - C G - C A C G - C G + T G - C G + T T A T C G T C C A C G A A | | | | | G G A C T C G C A G G C G | | | T T T C G A G C A A G TGACTATGTCTTC G - C C - G A - T G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |