Sequence ID | >WENV170652876 |
Genome ID | JRYH01066766 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 236 |
End posion on genome | 308 |
Amino Acid | Thr |
Anticodon | GGT |
Upstream region at tRNA start position |
acaggtttaa |
tRNA gene sequence |
GCAGGTGTAGCTCAGGGGTAGAGTGCTTCCTTGGTAAGGAAGAGGTCACGGGTTCAAATC |
Downstream region at tRNA end position |
nnnnnnnnnn |
Secondary structure (Cloverleaf model) | >WENV170652876 Thr GGT a TCnn nnnnnnnnnn G - C C - G A G G + T G + T T - A G - C T A T T G C C C A G A A | | | | | A G C T C G A C G G G C G | | | + T T G G A G T T A G AGGTC C - G T - A T - A C - G C - G T A T A G G T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |