Sequence ID | >WENV170652880 |
Genome ID | JRYH01070956 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1761 |
End posion on genome | 1685 |
Amino Acid | Arg |
Anticodon | CCG |
Upstream region at tRNA start position |
ttcgaatccc |
tRNA gene sequence |
GCACCCGTAGCTCAGTGGAGCAGAGCACCGTTTTCCGAGAGCGGAGGTCGCTGGTTCAAA |
Downstream region at tRNA end position |
gcaccatggg |
Secondary structure (Cloverleaf model) | >WENV170652880 Arg CCG c TCCA gcaccatggg G - C C - G A - T C - G C - G C - G G - C T A T C G A C C A T G A A | | | | | A G C T C G G C T G G C G | | | | T T A G A G C G C A A AGGTC C - G C - G G - C T + G T - A T G T A C C G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |