Sequence ID | >WENV170652881 |
Genome ID | JRYH01070956 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1353 |
End posion on genome | 1278 |
Amino Acid | Arg |
Anticodon | TCT |
Upstream region at tRNA start position |
cgcataccat |
tRNA gene sequence |
GCATCCGTAGCTCAGTGGACAGAGCGGCACTCTTCTAAAGTGACGGTCAAAGGTTCGAAT |
Downstream region at tRNA end position |
tcgcgacacc |
Secondary structure (Cloverleaf model) | >WENV170652881 Arg TCT t TCCA tcgcgacacc G - C C - G A - T T - A C - G C - G G - C T A T T T T C C A T G A A | | | | | G G C T C G A A A G G C G | | | | T T A G A G C C A G CGGTC G A C - G A - T C - G T - A C A T A T C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |