Sequence ID | >WENV170652882 |
Genome ID | JRYH01070956 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 925 |
End posion on genome | 851 |
Amino Acid | Val |
Anticodon | GAC |
Upstream region at tRNA start position |
gccaagaatg |
tRNA gene sequence |
GGGCGATTAGCTCAGCGGAAGAGCGTCTCCTTGACATGGAGAAGGTCGCAAGTTCAATCC |
Downstream region at tRNA end position |
tccctcgagc |
Secondary structure (Cloverleaf model) | >WENV170652882 Val GAC g ACCA tccctcgagc G - C G - C G - C C - G G - C A - T T - A C T T C G T T C A G A A | | | | | A C C T C G G C A A G C G | | | | T T G G A G C A A G AGGTC T - A C - G T - A C - G C - G T T T A G A C |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |