Sequence ID | >WENV170652883 |
Genome ID | JRYH01071265 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 762 |
End posion on genome | 689 |
Amino Acid | Gln |
Anticodon | CTG |
Upstream region at tRNA start position |
atcccggctt |
tRNA gene sequence |
TGGGGGAGCGTCTAATGGTAGGACTGCAGACTCTGACTCTGCCTGTCTAGGTTCGAATCC |
Downstream region at tRNA end position |
attttgcagg |
Secondary structure (Cloverleaf model) | >WENV170652883 Gln CTG t GCCA attttgcagg T - A G - C G - C G - C G - C G - C A - T T A G G A T C C A A A C | | | | | G T T C T G C T A G G C G + | | | T T G G G A C T A T CTGT G - C C - G A - T G - C A - T C C T A C T G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |