Sequence ID | >WENV170652885 |
Genome ID | JRYH01074173 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 194 |
End posion on genome | 281 |
Amino Acid | Leu |
Anticodon | TAG |
Upstream region at tRNA start position |
cagatcctgg |
tRNA gene sequence |
GCGAAAGTGGCGGAACCGGTAGACGCGCTGGGTTTAGGTCCCAGTGGGGTGCTCCCCCGT |
Downstream region at tRNA end position |
tccggcacgg |
Secondary structure (Cloverleaf model) | >WENV170652885 Leu TAG g ACCA tccggcacgg G - C C - G G - C A - T A - T A - T G - C T G T C T C T C A C A A G | | | | | G C G G C G G A G A G C G | | | T T G A C G C T A G G TGGGGTGCTCCCCCGT C - G T - A G - C G - C G - C T T T G T A G |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |