Sequence ID | >WENV170652886 |
Genome ID | JRYH01076585 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 87 |
End posion on genome | 12 |
Amino Acid | Arg |
Anticodon | CCT |
Upstream region at tRNA start position |
cagccccaac |
tRNA gene sequence |
GCCCCGGTAGCCCAGTGGATAGAGCAACCGCCTCCTAAGCGGTAGGTCGCAGGTTCGATT |
Downstream region at tRNA end position |
tatacccttc |
Secondary structure (Cloverleaf model) | >WENV170652886 Arg CCT c GCCA tatacccttc G - C C - G C - G C - G C - G G - C G - C T T T C G T C C A T G A A | | | | | G G C C C G G C A G G C G | | | T T A G A G C T A A AGGTC A - T C - G C - G G - C C - G C A T A C C T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |