Sequence ID | >WENV170652887 |
Genome ID | JRYH01076695 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1101 |
End posion on genome | 1025 |
Amino Acid | Met |
Anticodon | CAT |
Upstream region at tRNA start position |
ttcggctttc |
tRNA gene sequence |
GGTGGTATAGCTCAGCTGGTTAGAGCGCGGGATTCATAACCCCGAGGTCGGTGGTTCAAT |
Downstream region at tRNA end position |
atttgtgagg |
Secondary structure (Cloverleaf model) | >WENV170652887 Met CAT c ACCA atttgtgagg G - C G - C T - A G - C G - C T - A A - T C T T C C A C C A C G A A | | | | | A T C T C G G G T G G C G | | | | T T G G A G C T T A G AGGTC C - G G - C G - C G - C A C T A T A C A T |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |