Sequence ID | >WENV170652888 |
Genome ID | JRYH01077901 |
Phylum/Class | [JRYH] activated sludge metagenome; activated biomass of a wastewater treatment plant treating wastewater generated at dyes and |
Species | |
Start position on genome | 1 |
End posion on genome | 92 |
Amino Acid | Tyr |
Anticodon | GTA |
Upstream region at tRNA start position |
nnnnnnnnnn |
tRNA gene sequence |
GCGTCGGCGGCAAAGATGGCGGTGTTGCGCTTGACTGTAAATCAAGTCCCATAGGGTAAA |
Downstream region at tRNA end position |
attttttaga |
Secondary structure (Cloverleaf model) | >WENV170652888 Tyr GTA n ACCA attttttaga G - C C - G G - C T + G C - G G - C G - C T A C T T A C C A T A G A G | + | | | G G A A C G A G T G G C G | | | | T T C T T G C G G T G G TCCCATAGGGTAAACATT C - G T - A T - A G - C A - T C A T A G T A |
Intron | |
Comment/Decision | |
Genome/Seq. Info. | [ENA] |
Comment | |
--- | |
Input Comment |